Genetic Diversity of Salvia Officinalis L. (Lamiaceae) and its Related Species using TU-DAMD Analysis

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Genetic Diversity of Salvia Officinalis L. (Lamiaceae) and its Related Species using TU-DAMD Analysis

Basel Saleh1 , * Open Modal
Authors Info & Affiliations
The Open Agriculture Journal • 21 Jun 2023 • RESEARCH ARTICLE • DOI: 10.2174/18743315-v17-e230517-2022-65

Abstract

Background:

Salvia tomentosa Mill., Salvia fruticosa Mill., and Salvia officinalis L. are Mediterranean species with different pharmaceutical and medicinal applications. However, genetic relationships among these species are still unclear.

Objective:

The study aimed to investigate the genetic polymorphism among S. officinalis L. (SO) and its related species S. tomentosa Mill. (ST) and S. fruticosa Mill. (SF) collected from different geographical regions in Syria.

Methods:

Touch-up directed amplification of minisatellite DNA (TU-DAMD) assay has been employed to assess genetic relationships among the studied Salvia species based on the estimated percent disagreement values (PDV).

Results:

Seventeen DAMD primers highlighted a mean of 90.419, 0.254, and 2.398% for polymorphism level (P%), polymorphic information content (PIC), and marker index (MI) values, respectively, across the three studied Salvia species. Unweighted Pair Group Mean Arithmetic average (UPGMA) analysis revealed that the studied Salvia samples were clustered into three main clusters; each species was split into one cluster. Overall, moderate P% of 72.662 and 70.374% was recorded for SO and ST species, respectively. Whereas, low P% of 51.429% was recorded for SF species.

Conclusion:

TU-DAMD marker is a potential tool for studying genetic relationships among the three studied Salvia species.

Keywords: Salvia officinalis, Salvia tomentosa, Salvia fruticosa, TU-DAMD marker, Genetic diversity, Minisatellite.

1. INTRODUCTION

Salvia is one of the largest plant genera. This genus includes approximately 1000 species [1] and belongs to the Lamiaceae family. Around 250 species of this genus are common in the Mediterranean regions, and the Salvia officinalis group consists of 11 species [2]. Among these 11 species, S. officinalis L., S. tomentosa Mill., and S. fruticosa Mill. species are the most three prominent species in the Mediterranean region [3].

According to Mouterde [4], S. tomentosa Mill (Tomentose sage) is native to areas ranging from South-East Europe to Transcaucasia, including Albania, Bulgaria, East Aegean Is., Greece, Krym, Lebanon, Syria, Transcaucasus, Turkey, and Yugoslavia [5]. Whereas, S. fruticosa Mill. (Greek sage) is a native species of the East Mediterranean basin and distributed from Italy, Sicily, and Cyrenaica through the South Balkan Peninsula (Albania and Greece) to West Syria [2]. Wild populations of these two species are widespread in Lebanon and Syria [4]. Conversely, S. officinalis L. (Common sage or Dalmatian sage) is native to the northern coast of Mediterranean regions and grows under wild type in the calcareous mountains of northern and central Spain, southern France, and the western part of the Balkan Peninsula [2, 6], and also to the Middle East and Mediterranean areas [7].

Whereas, S. tomentosa Mill. and S. fruticosa Mill. are present as wild, endemic species in Syria; however, the occurrence of wild S. officinalis L. among the Syrian flora is not mentioned by Mouterde [4].

Among the different Salvia species, Salvia officinalis L. displays the most valuable importance as an ornamental and medicinal plant. Due to its richness in bioactive compounds, it has a broad spectrum of uses ranging from food, pharmacology, and medicine to cosmetic applications [7-9]. It has been demonstrated that S. officinalis as a Mediterranean plant is characterized by exhibiting a high level of genetic diversity at the plastid genome (HT = 0.695) (as reported in other native aromatic/medicinal plants) and at nuclear DNA levels [8]. However, the genetic diversity in the canter of its origin is still unclear [3].

It has been demonstrated that some Salvia species have different pharmaceutical, medicinal, and industrial applications due to the richness of the essential oil in their bioactive components [7]. In Syria, they were used in folk medicine against winter diseases.

In Syria, S. tomentosa Mill. and S. fruticosa Mill. are known as miramiya, meramiya, mariamiya, and mirimiyah; they have a common Arabic name with a minor difference. S. officinalis is named cultivated mirimiyah, whereas S. fruticosa and S. tomentosa are known as wild mirimiyah. This classification is mainly based on their aromatic compounds. Mouterde [4] reported inferior aromatic compounds in S. fruticosa compared to S. officinalis. In Lebanon, S. fruticosa (syn. S. triloba L.fil. or S. libanotica Boiss. et Gaill) is an endemic species and named as mirimiyah or kas’in in Arabic. Indeed, this label was extended to Palestine and Jordan.

The molecular characterization of a given plant species is a potent tool for its conservation and breeding programs. DNA genetic variation within each Salvia species has been assessed in many reports. In this regard, generic polymorphism in S. officinalis L. has been assessed using random amplified polymorphic DNA (RAPD) markers [3, 10, 11]; single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers [6, 9, 12, 13]; plastid DNA intergenic spacers [8]; inter simple sequence repeat (ISSR) markers [14], and recently, by amplified fragment length polymorphism (AFLP) markers [15]. As for S. fruticosa, RAPD markers [16] and microsatellites [17] have been used.

Different molecular marker systems have also been employed to study the genetic relationships within other Salvia species, for e.g., in S. hispanica L., by using the RAPD markers [18]; in S. lachnostachys, by using the ISSR markers [19], sequence-related amplified polymorphism (SRAP) and ISSR [20], and ISSR markers [21]; in S. lutescens var. intermedia, by using nuclear ribosomal DNA and plastid DNA sequences [22]; in S. divinorum, by using chloroplast simple sequence repeats (cpSSR's) [23]; in S. japonica, by using chloroplast and nuclear ribosomal DNA sequences and allozyme polymorphisms [24], and in S. euphratica sensu lato by using the internal transcribed spacer (ITS) and chloroplast DNA regions [trnT-trnL intergenic spacer (IGS)] markers [25].

Touch-down directed amplification of minisatellite DNA polymerase chain reaction (TD-DAMD-PCR) marker among various molecular markers available nowadays has been successfully employed for DNA genetic variability assessment in different plant crops, for e.g., in common bean landraces [26], Salvia species [27], Allium sp [28], carnation cultivars [29], commercial cotton [30], and S. tomentosa [31].

TU-DAMD assay has been recently employed to study the genetic diversity in Salvia judaica and Salvia palaestina [32], and more recently in Origanum syriacum L [33].

The genetic structure of plant populations reflects various interaction processes involving various phenomena (long-term evolutionary history of the species (shift in distribution, habitat fragmentation, and population isolation), mutations, genetic drifts, mating system, gene flow, and selection).

DNA genetic variability within S. officinalis group has not been investigated neither in Syria nor worldwide yet. In particular, studies relative to the Mediterranean S. officinalis L., S. tomentosa Mill., and S. fruticosa Mill. species are still lacking. Therefore, the current study has been conducted to assess the genetic relationships of S. officinalis and its related species using the TU-DAMD molecular marker.

2. MATERIALS AND METHODS

2.1. Sampling

Samples were collected from different geographical regions in Syria (Table 1). Cultivated accessions of S. officinalis L. (SO) (10 samples (2 from Lattakia, 2 from Jableh, 1 from Tartous, 2 from Hama, 2 from Damascus, and 1 from Darra), and natural populations of S. tomentosa Mill (ST) (5 samples (3 from Lattakia, 1 from Tartous, and 1 from Hama) and S. fruticosa Mill (SF) (4 samples (1 from Lattakia, 1 from Jableh, 1 from Banyas and 1 from Tartous) were collected from different location sites in Syria. Moreover, wild Origanum syriacum L. (Lamiaceae) species collected from Lattakia was used as the reference. Leaf sampling has been carried out during the blooming stage.

2.2. Genomic DNA Extraction

Leaf genomic DNA of the studied samples was isolated using CTAB (cetyltrimethylammonium bromide) as in the protocol described by Doyle and Doyle [34]. DNA fluorimeter instrument was used to determine DNA concentration. DNA was stored at –80°C until use.



Table 1.
Collection sites description of the three studied Salvia species along with O. syriacum.
Species Collection Site Code Altitude (m) Annual Rainfall (mm)
S. officinalis Lattakia SOL1 20 800
Lattakia SOL2 60 800
Jableh SOJ3 20 1200
Jableh SOJ4 20 1200
Tartous SOT5 247 1400
Hama SOH6 170 750
Hama SOH7 500 1500
Damascus SOD8 950 260
Damascus SOD9 800 300
Darra SOD10 780 500
S. tomentosa Lattakia STL11 400 1100
Lattakia STL12 134 800
Lattakia STL13 540 1100
Tartous STT14 377 1500
Hama STH15 300 1400
S. fruticosa Lattakia SFL16 650 110
Jableh SFJ17 75 1200
Banyas SFB18 485 1400
Tartous SFT19 890 1400
O. syriacum Lattakia OS 80 800
Table 2.
DAMD primers used in the current study.
Primer No. Primer Name Primer Sequence 5'-3'
1 URP1F ATCCAAGGTCCGAGACAACC
2 URP2R CCCAGCAACTGATCGCACAC
3 URP9F ATGTGTGCGATCAGTTGCTG
4 URP30F GGACAAGAAGAGGATGTGGA
5 URP38F AAGAGGCATTCTACCACCAC
6 OGRB01 AGGGCTGGAGGAGGGC
7 FVIIex8 ATGCACACACACAGG
8 HBV3 GGTGAAGCACAGGTG
9 14C2 GGCAGGATTGAAGC
10 33.6 GGAGGTGGGCA
11 PM13 GAGGGTGGCGGCTCT
12 HBVb GGTGTAGAGAGAGGGGT
13 HVR GGAGGTTTTCA
14 URP6R GGCAAGCTGGTGGGAGGTAC
15 URP17R AATGTGGGCAAGCTGGTGGT
16 M13 GAGGGTGGCGGTTCCT
17 HVV GGTGTAGAGAGGGGT

2.3. TU-DAMD Assay

DNA genetic variability among the Mediterranean S. officinalis L., S. tomentosa Mill., and S. fruticosa Mill. species has been investigated using seventeen DAMD primers (Table 2). TU-DAMD assay was performed as more recently described by Saleh [32] in 25 μl total volume using a T-gradient thermal cycler (Bio-Rad, Hercules, USA) programmed as follows: 1 cycle for 4 min at 94 ºC, followed by ten cycles of pre-PCR involving 30 s at 94 °C for denaturation, 45 s at 55 °C for annealing, and 3 min at 72 °C for extension. The annealing temperature was increased by 0.5 °C/cycle for the first 10 cycles. Then, 30 cycles were carried out at a constant temperature of 55 °C as the annealing temperature, followed by a final extension at 72 °C for 10 min. Final PCR products were separated on a 2% ethidium bromide-stained agarose (Bio-Rad) in 0.5× Tris-borate-EDTA (TBE) buffer. Electrophoresis was carried out at 85 V for 2.5 h and visualized with a UV transilluminator. The molecular weight of TU-DAMD amplification products was estimated using a VC 100bp Plus DNA Ladder (Vivantis) standard.

2.4. TU-DAMD Data Analysis

Band scoring has been manually done as 0 or 1 for the absence or presence of each band size, respectively. The Unweighted Pair Group Mean Arithmetic average (UPGMA) analysis using the Statistica program [35] was constructed based on percent disagreement values (PDV). Genetic similarity among the three studied Salvia samples was determined [36]. Indeed, polymorphic information content (PIC) was determined [37] according to the following formula:

PIC = 1 ‒ Σ(Pij)2

Where, Pij is the frequency of the ith pattern revealed by the jth primer summed across all patterns revealed by the primers. Moreover, the marker index (MI) was also determined [38] according to the following formula:

MI = PIC × ηβ

Where, PIC is the mean PIC value, η is the number of bands, and β is the proportion of polymorphic information.

3. RESULTS

TU-DAMD markers produced PCR products with sizes ranging from 100-3000 bp. TU-DAMD polymorphism among the studied species yielded by OGRB01, 14C2, and M13 DAMD primers is shown in Fig. (1). The different primers produced a total band number ranging from 4 (HVR) to 19 (14C2) with a mean average of 9.824 bands/primer (Table 3). The number of polymorphic bands ranged between 2 (HVR) and 19 (14C2) with a mean average of 8.882 polymorphic bands/primer (Table 3). Six DAMD (URP2R, URP30F, FVIIex8, HBV3, 14C2, and M13) primers among the 17 DAMD-tested primers successfully produced a polymorphism level of 100%. Whereas, for the remaining primers, this value ranged between 50% (HVR) and 92.308% (HVV) (Table 3). Indeed, the PIC value ranged between 0.140 (URP9F) and 0.368 (M13) with a mean average of 0.254. As for MI, it ranged between 0.360 (HVR) and 6.175 (14C2) with a mean average of 2.398. In general, the TU-DAMD marker highlighted a mean average value of 90.419%, 0.254, and 2.398 for P%, PIC, and MI, respectively, across the three studied species (Table 3).

Genotypic-specific markers ranged between 0 (SOJ3) and 10 (SOH7) (Table 4). TU-DAMD assay highlighted 68 total genotypic-specific markers; they were 31, 19, and 18 for SO, ST, and SF species, respectively. Two DAMD primers (HVR and 33.6) did not reveal genotypic-specific markers among all the tested samples. Whereas, for the remaining 15 DAMD primers, this value varied from 1 (URP2R and M13) to 10 (HVV) with respect to genotypic-specific markers (Table 4).

Fig. (1). TU-DAMD polymorphism pattern among the three studied Salvia species as yielded by OGRB01 (a), 14C2 (b), and M13 (c) DAMD primers. S. officinalis (lanes 1-10), S. tomentosa (lanes 11-15), S. fruticosa (lanes 16-19) and O. syriacum (lane 20). M: VC 100bp Plus DNA Ladder (Vivantis) standard.

Table 3.
TU-DAMD data including total bands (TB), polymorphic bands (PB), polymorphic % (P %), polymorphic information content (PIC), and marker index (MI) values.
Primer Name TB PB P% PIC MI
URP1F 11 10 90.909 0.249 2.490
URP2R 10 10 100.000 0.320 3.200
URP9F 5 3 60.000 0.140 0.420
URP30F 8 8 100.000 0.290 2.320
URP38F 11 10 90.909 0.246 2.460
OGRB01 11 8 72.727 0.177 1.416
FVIIex8 8 8 100.000 0.260 2.080
HBV3 9 9 100.000 0.260 2.340
14C2 19 19 100.000 0.325 6.175
33.6 8 6 75.000 0.260 1.560
PM13 11 10 90.909 0.368 3.680
HBVb 7 6 85.714 0.270 1.620
HVR 4 2 50.000 0.180 0.360
URP6R 7 6 85.714 0.210 1.260
URP17R 11 10 90.909 0.215 2.150
M13 14 14 100.000 0.284 3.976
HVV 13 12 92.308 0.271 3.252
Total 167 151 - - -
Average 9.824 8.882 87.359 0.254 2.398
Table 4.
Genotypic-specific markers characterizing the three studied Salvia species based on TU-DAMD data.
Primer Name SOL1 SOL2 SOJ3 SOJ4 SOT5 SOH6 SOH7 SOD8 SOD9 SOD10 STL11 STL12 STJ13 STT14 STH15 SFL16 SFJ17 SFB18 SFT19 Total
URP1F 1 1 0 0 0 1 0 0 0 1 1 0 0 1 0 0 0 0 0 6
URP2R 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1
URP9F 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 3
URP30F 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3
URP38F 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 0 4
OGRB01 0 0 0 0 1 0 0 1 0 0 1 1 0 0 1 1 1 0 0 7
FVIIex8 0 0 0 0 1 0 1 0 1 0 0 0 0 0 0 0 1 0 0 4
HBV3 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 1 1 1 5
14C2 0 0 0 0 1 0 2 0 0 0 0 1 1 0 0 0 0 1 0 6
33.6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
PM13 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1
HBVb 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2
HVR 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
URP6R 0 1 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 3
URP17R 1 1 0 0 0 0 1 0 0 0 0 1 1 0 0 0 0 0 1 6
M13 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 2 2 0 7
HVV 0 0 0 1 0 1 2 0 0 0 1 2 0 0 0 1 1 1 0 10
Total 4 5 0 1 5 2 10 1 2 1 6 8 3 1 1 3 6 5 4 68
SO Total 31 - - - - - - - - - - - - - - - - - - -
ST Total 19 - - - - - - - - - - - - - - - - - - -
SF Total 18 - - - - - - - - - - - - - - - - - - -

Clustering analysis has been conducted based on PDV (Fig. 2). This analysis showed that O. syriacum L. is genetically distant from the studied Salvia samples, as expected. More than this, it showed that Salvia samples are clustered into three main groups. The first cluster included SO samples of which SOT5 & SOH7 were genetically distinct from the remaining studied SO samples (PDV of 0.22 and similarity of 0.71) (Tables 5 and 6). Whereas, the second one included ST samples divided into two subclusters, with the first subcluster including STL11 and STL12 (PDV of 0.14 and similarity of 0.76) (Tables 5 and 6) and the second subcluster including STT14, STH15, and STL13. While, the third cluster included studied SF samples and divided itself into two subclusters; the first subcluster included SFL16 and SFT19 (PDV of 0.13 and similarity of 0.76), whereas the second one included SFJ17 and SFB18 (PDV of 0.06 and similarity of 0.91) (Tables 5 and 6). Tables 5 and 6 showed that the closest samples were SFJ17 and SFB18, exhibiting the lowest PDV of 0.06 and the highest similarity of 0.91. Whereas, the most distant samples were SOD8 and SFJ17 (PDV of 0.38 and similarity of 0.48) (Tables 5 and 6).

Table 5.
Percent disagreement values (PDV) among the three studied Salvia species based on TU-DAMD data.
Genotype SOL1 SOL2 SOJ3 SOJ4 SOT5 SOH6 SOH7 SOD8 SOD9 SOD10 STL11 STL12 STJ13 STT14 STH15 SFL16 SFJ17 SFB18 SFT19 OS
SOL1 0.00 - - - - - - - - - - - - - - - - - - -
SOL2 0.10 0.00 - - - - - - - - - - - - - - - - - -
SOJ3 0.14 0.11 0.00 - - - - - - - - - - - - - - - - -
SOJ4 0.16 0.13 0.09 0.00 - - - - - - - - - - - - - - - -
SOT5 0.21 0.18 0.14 0.16 0.00 - - - - - - - - - - - - - - -
SOH6 0.18 0.12 0.09 0.13 0.11 0.00 - - - - - - - - - - - - - -
SOH7 0.27 0.27 0.21 0.23 0.22 0.19 0.00 - - - - - - - - - - - - -
SOD8 0.22 0.18 0.13 0.15 0.17 0.10 0.19 0.00 - - - - - - - - - - - -
SOD9 0.21 0.19 0.17 0.17 0.17 0.13 0.16 0.11 0.00 - - - - - - - - - - -
SOD10 0.20 0.15 0.10 0.14 0.12 0.09 0.21 0.09 0.12 0.00 - - - - - - - - - -
STL11 0.28 0.26 0.22 0.25 0.21 0.22 0.31 0.26 0.27 0.22 0.00 - - - - - - - - -
STL12 0.30 0.28 0.25 0.26 0.24 0.24 0.32 0.30 0.26 0.26 0.14 0.00 - - - - - - - -
STJ13 0.27 0.25 0.22 0.22 0.23 0.24 0.34 0.26 0.26 0.22 0.18 0.16 0.00 - - - - - - -
STT14 0.27 0.27 0.26 0.24 0.28 0.28 0.33 0.30 0.33 0.25 0.18 0.22 0.18 0.00 - - - - - -
STH15 0.23 0.22 0.17 0.19 0.21 0.21 0.28 0.24 0.28 0.20 0.12 0.19 0.14 0.10 0.00 - - - - -
SFL16 0.30 0.32 0.28 0.28 0.30 0.29 0.35 0.31 0.32 0.28 0.25 0.29 0.24 0.24 0.20 0.00 - - - -
SFJ17 0.33 0.36 0.31 0.33 0.36 0.35 0.37 0.38 0.36 0.35 0.32 0.33 0.32 0.28 0.26 0.17 0.00 - - -
SFB18 0.32 0.33 0.29 0.30 0.31 0.33 0.37 0.35 0.36 0.30 0.29 0.32 0.29 0.26 0.24 0.14 0.06 0.00 - -
SFT19 0.30 0.31 0.28 0.28 0.31 0.32 0.36 0.33 0.36 0.29 0.26 0.33 0.25 0.24 0.23 0.13 0.17 0.13 0.00 -
OSL 0.41 0.43 0.41 0.44 0.46 0.45 0.47 0.46 0.46 0.43 0.41 0.44 0.40 0.39 0.34 0.42 0.44 0.43 0.39 0.00

Fig. (2). TU-DAMD clustering analysis constructed based on PDV value among the three studied Salvia species.
Table 6.
Nei and Li genetic similarity (GS) index among the three studied Salvia species based on TU-DAMD data.
Genotype SOL1 SOL2 SOJ3 SOJ4 SOT5 SOH6 SOH7 SOD8 SOD9 SOD10 STL11 STL12 STJ13 STT14 STH15 SFL16 SFJ17 SFB18 SFT19 OS
SOL1 1.00 - - - - - - - - - - - - - - - - - - -
SOL2 0.84 1.00 - - - - - - - - - - - - - - - - - -
SOJ3 0.78 0.83 1.00 - - - - - - - - - - - - - - - - -
SOJ4 0.75 0.79 0.86 1.00 - - - - - - - - - - - - - - - -
SOT5 0.67 0.73 0.80 0.76 1.00 - - - - - - - - - - - - - - -
SOH6 0.72 0.82 0.87 0.81 0.84 1.00 - - - - - - - - - - - - - -
SOH7 0.61 0.63 0.72 0.68 0.71 0.75 1.00 - - - - - - - - - - - - -
SOD8 0.67 0.74 0.82 0.78 0.77 0.87 0.76 1.00 - - - - - - - - - - - -
SOD9 0.68 0.73 0.77 0.75 0.76 0.83 0.79 0.85 1.00 - - - - - - - - - - -
SOD10 0.69 0.78 0.86 0.80 0.83 0.87 0.73 0.88 0.84 1.00 - - - - - - - - - -
STL11 0.50 0.56 0.63 0.57 0.66 0.66 0.53 0.61 0.58 0.64 1.00 - - - - - - - - -
STL12 0.51 0.57 0.61 0.58 0.63 0.64 0.55 0.57 0.62 0.61 0.76 1.00 - - - - - - - -
STJ13 0.54 0.59 0.65 0.63 0.63 0.62 0.51 0.62 0.60 0.65 0.67 0.74 1.00 - - - - - - -
STT14 0.51 0.52 0.56 0.57 0.53 0.53 0.50 0.53 0.46 0.59 0.65 0.60 0.66 1.00 - - - - - -
STH15 0.58 0.61 0.70 0.66 0.65 0.66 0.57 0.62 0.56 0.67 0.76 0.67 0.74 0.80 1.00 - - - - -
SFL16 0.52 0.52 0.58 0.58 0.55 0.58 0.52 0.57 0.55 0.61 0.58 0.55 0.61 0.59 0.66 1.00 - - - -
SFJ17 0.49 0.46 0.55 0.51 0.49 0.51 0.51 0.48 0.51 0.51 0.49 0.51 0.50 0.52 0.58 0.76 1.00 - - -
SFB18 0.49 0.48 0.56 0.53 0.53 0.52 0.49 0.50 0.49 0.56 0.51 0.50 0.53 0.55 0.59 0.79 0.91 1.00 - -
SFT19 0.48 0.49 0.54 0.52 0.50 0.50 0.47 0.51 0.45 0.54 0.52 0.45 0.55 0.54 0.57 0.79 0.74 0.79 1.00 -
OSL 0.33 0.33 0.37 0.30 0.31 0.34 0.34 0.34 0.33 0.36 0.30 0.29 0.34 0.30 0.40 0.35 0.34 0.33 0.34 1.00

4. DISCUSSION

DNA genetic variation among Salvia officinalis L. (SO), and its related species of S. tomentosa Mill. (ST) and S. fruticosa Mill. (SF), collected from different geographical regions in Syria, has been assessed using the TU-DAMD assay.

For S. officinalis, the application of the TU-DAMD marker showed a polymorphism level (P%) of 72.662% among the ten studied samples. Whereas, other reports revealed that this value for the same species varied between 32.03%-90%. Our data were compared with those reported by other investigations. In this regard, it was recorded to be 90% [14], 80.681% [3], 63.54% [13], 59.5% [11], 57.2% [10], and 32.03% [39], respectively. This difference could be attributed to the following factors: I. Studied population type and size, wherein the current study, samples were introduced, cultivated, and domesticated under different climatic conditions varied from dry to wet; while, for the other investigations, genetic diversity was carried out on natural populations. II. Marker system employed and primers number, wherein the current study, TU-DAMD marker was employed, whereas in the other investigations, RAPD [3, 10, 11] and ISSR [14, 39] have been employed. It has been demonstrated that species, geographical distribution, selection, and cross-pollination are considered the main factors affecting genetic diversity in Salvia species [40]. Genetic diversity observed in S. officinalis species in the current study compared to other ones has been summarized in Table 7.

Overall, the current study revealed P% to be 72.662, 70.374, and 51.429% for SO, ST, and SF species, respectively. This observation has been reported to be consistent with previous and recent published reports on the Salvia genetic diversity at the species level. Regarding this index, our data was found to be between 32.03% in S. officinalis [39] and 95.6% in S. lachnostachys [19]. reported in the related literature.


Table 7.
A comparative study between the genetic diversity of S. officinalis species in the current study and other ones.
Molecular Marker Results P% References
17 TU-DAMD - 72.66 Current study
RAPD 88 TB and 71 PB (ranged between 4-13 bands) with an average of 8.9 80.68 [3]
8 SSR 165 total alleles (ranging from 13-30) and PIC ranging between 0.63-0.94, with an average of 0.81 - [9]
39 RAPD TB ranging between 2-13 bands and PB ranging between 0-12 bands 57.20 [10]
RAPD - 59.50 [11]
9 SSR 125 TB (ranging between 8-21 loci) and PIC ranging between 0.70-0.92, with an average of 0.841 63.54 [13]
ISSR - 90.00 [14]
4 AFLP PCs - 63.54 [15]
16 ISSR 128 TB (ranging between 3-16 bands) and 41 PB (ranging between 1-5 bands) 32.03 [39]

Echeverrigaray and Agostini [11] reported P% to be 59.5% within S. officinalis only and to be 73% when S. officinalis and S. sclarea were introduced together in genetic analysis, using the RAPD marker. Whereas, Boszrmenyi et al. [10] reported P% to be 57.2% in S. officinalis and 83.6% when S. judaica was introduced in the genetic analysis using the RAPD marker. Moreover, Mader et al. [12] reported genetic variability among 19 accessions of S. officinalis using SNP and SSR markers. They reported that the AMOVA test revealed 51% of the variance between the populations and 49% within the principal component analysis and that the samples were clustered in the main cluster. Whereas, Radosavljević et al. [6] reported a mean PIC of 0.802 in wild and cultivated populations of common sage S. officinalis L. using SSR loci. Indeed, Radosavljević et al. [13] reported a mean PIC of 0.841 in Salvia officinalis L. natural population using SSR loci.

Liber et al. [3] reported a P% of 80.681% using the RAPD marker among ten natural populations of S. officinalis. They reported that molecular variance analysis (AMOVA) showed most DNA genetic variation to be related to differences among the studied samples within populations, and also that genetic differences were recorded among the populations. Whereas, Rešetnik et al. [9] reported a PIC average of 0.81 within S. officinalis population using the SSR loci. They reported clear genetic DNA polymorphism between wild and cultivated S. officinalis populations restricted from one geographical region using SSR markers.

Moreover, Sarrou et al. [14] reported a P% of 90% in 7 S. officinalis populations using the ISSR marker. Whereas, Altindal [39] reported a P% of 32.03% among 8 S. officinalis samples using the ISSR marker. Recently, Jug-Dujaković1 et al. [15] reported a P% average of 63.54% in S. officinalis using the AFLP marker.

Previously, Skoula et al. [16] reported 155 total bands among 48 S. fruticosa clones using the RAPD marker. Whereas, Leontaritou et al. [17] reported high genetic diversity within the same species using the microsatellites marker.

Tychonievich and Warner [41] reported that spontaneous hybrids occurred either in the wild or in cultivated type due to intentional crosses between S. officinalis and S. lavandulifolia, and also between S. fruticosa and S. tomentosa.

Genetic diversity in other Salvia species has also been investigated. In this regard, Cahill [18] reported DNA genetic diversity in S. hispanica L. using the RAPD marker as higher among wild types compared to domesticated and commercial types. Whereas, Song et al. [20] reported high genetic similarity reflecting low genetic diversity in S. miltiorrhiza using SRAP and ISSR markers. Indeed, Zhang et al. [21] reported the high importance of DNA genetic diversity of S. miltiorrhiza using ISSR marker in plant breeding programs. Moreover, Saleh [31] reported a P% of 82.911% combined with 0.264 and 2.269 for PIC and MI average values, respectively, in S. tomentosa using the TD-DAMD analysis.

Recently, Saleh [32] reported low genetic diversity (P%) in S. judaica (40.45%) and S. palaestina (42.31%) species, whereas a high genetic diversity of 90.00% has been recorded between the two mentioned species using the TU-DAMD marker.

Based upon TU-DAMD data presented herein, the current study revealed moderate genetic diversity (P%) of 72.662 and 70.374% for SO and ST species, respectively. Whereas, low genetic diversity of 51.429% has been recorded for SF species. While high genetic diversity of 90.419% has been recorded across the three studied Salvia species.

Genetic diversity observed across the three studied Salvia species in the current study could be attributed to outcrossing process, as similarly reported for S. officinalis [8], or variation between wild or cultivated S. officinalis species [9], or to spontaneous hybrids occurring either in the wild or cultivated Salvia species [41]; it can also be due to an interspecific hybrid, as similarly reported in S. divinorum [23], or reproductive biology, gene flow, seed dispersal, and nature selection [19]. These events have encouraged efficient gene flow, leading finally to heterozygosity and genetic diversity expansion.

CONCLUSION

Genetic diversity across the three studied Salvia species (S. officinalis L., S. tomentosa Mill., and S. fruticosa Mill.) grown in different geographical regions in Syria has been investigated through the TU-DAMD marker. This marker successfully discriminates among the three studied Salvia species. Cluster analysis revealed that the three studied Salvia species were clustered in three main clusters, with each cluster associated separately with each species. Due to the recent success of the TU-DAMD marker for the assessment of the genetic diversity of S. judaica, S. palaestina, and O. syriacum L. species, it is worth noting to expand its employment in molecular studies in order to discover its effectiveness in genetic diversity assessment of other plants species. Over all, the current investigation could be considered as the first report highlighting the genetic relationships among the three prominent Salvia species grown in Mediterranean regions. The genetic diversity observed among the three studied Salvia species could be considered as a potential tool to be exploited in Salvia breeding programs. The current study provides a useful tool to be integrated with the genetic and phytochemical diversity of these species, providing a potential benefit to plant breeding programs.

LIST OF ABBREVIATIONS

AFLP = Amplified fragment length polymorphism
cpSSR's = Chloroplast simple sequence repeats
CTAB = Cetyltrimethylammonium bromide
DAMD = Directed amplification ‎of minisatellite-region DNA
ISSR = Inter simple sequence repeats
MI = Marker index
P% = Percentage polymorphism
PB = Polymorphic bands
PIC = Polymorphic information content
PDV = Percent disagreement values
RAPD = Random amplified polymorphic DNA
SNP = Single nucleotide polymorphism
SRAP = Sequence-related amplified polymorphism
SSRs = Simple sequence repeats
TB = Total bands
TD-DAMD = Touch-down directed amplification of minisatellite DNA
TU-DAMD = Touch-up directed amplification of minisatellite DNA
UPGMA = Unweighted pair group mean arithmetic average

CONSENT FOR PUBLICATION

Not applicable.

AVAILABILITY OF DATA AND MATERIALS

The data supporting the findings of the article will be available from the author [B.S] upon request.

FUNDING

This study was supported by the Department of Molecular Biology and Biotechnology, Atomic Energy Commission of Syria, P.O. Box 6091, Damascus, Syria.

CONFLICT OF INTEREST

The author declares no conflict of interest.

ACKNOWLEDGEMENTS

The author thanks Dr. I. Othman (Director General of AECS) and Dr. N. Mirali (Head of Molecular Biology and Biotechnology Department in AECS) for their support, and also the Plant Biotechnology group for technical assistance.

REFERENCES

1
Walker JB, Sytsma KJ, Treutlein J, Wink M. Salvia (Lamiaceae) is not monophyletic: Implications for the systematics, radiation, and ecological specializations of Salvia and tribe Mentheae. Am J Bot 2004; 91(7): 1115-25.
2
Hedge IC. Salvia L. In: Davis PH, Ed. Flora of Turkey and the East Aegean islands 7. Edinburgh 1982; pp. 188-92.
3
Liber Z, Židovec V, Bogdanović S, et al. Genetic diversity of Dalmatian Sage (Salvia officinalis L.) as assessed by RAPD markers. ACS Agric Conspec Sci 2014; 79(2): 77-84.
4
Mouterde PSJ. Nouvelle Flore du Liban et de la Syria 1983; 3: 159-70.
5
Govaerts R. World Checklist of Selected Plant Families Database in ACCESS. Kew: The Board of Trustees of the Royal Botanic Gardens 2003; pp. 1-216203.
6
Radosavljević I, Jakse J, Javornik B, Satovic Z, Liber Z. New microsatellite markers for Salvia officinalis (Lamiaceae) and cross-amplification in closely related species. Am J Bot 2011; 98(11): e316-8.
7
Ghorbani A, Esmaeilizadeh M. Pharmacological properties of Salvia officinalis and its components. J Tradit Complement Med 2017; 7(4): 433-40.
8
Stojanović D, Aleksić JM, Jančić I, Jančić R. A Mediterranean medicinal plant in the continental Balkans: A plastid DNA-based phylogeographic survey of Salvia officinalis ( Lamiaceae ) and its conservation implications. Willdenowia 2015; 45(1): 103-18.
9
Rešetnik I, Baričevič D, Batîr Rusu D, et al. Genetic diversity and demographic history of wild and cultivated/naturalised plant populations: Evidence from Dalmatian Sage (Salvia officinalis L., Lamiaceae). PLoS One 2016; 11(7): e0159545.
10
Böszörményi A, Héthelyi É, Farkas Á, et al. Chemical and genetic relationships among sage ( Salvia officinalis L.) cultivars and Judean sage ( Salvia judaica Boiss.). J Agric Food Chem 2009; 57(11): 4663-7.
11
Echeverrigaray S, Agostini G. Genetic relationships between commercial cultivars and Brazilian accessions of Salvia officinalis L. based on RAPD markers. Rev Bra de Plantas Medicinais, Botucatu 2006; 8: 13-7.
12
Mader E, Lohwasser U, Börner A, Novak J. Population structures of genebank accessions of Salvia officinalis L. (Lamiaceae) revealed by high resolution melting analysis. Biochem Syst Ecol 2010; 38(2): 178-86.
13
Radosavljević I, Šatović Z, Jakse J, et al. Development of new microsatellite markers for Salvia officinalis L. and its potential use in conservation-genetic studies of narrow endemic Salvia brachyodon Vandas. Int J Mol Sci 2012; 13(12): 12082-93.
14
Sarrou E, Ganopoulos I, Xanthopoulou A, et al. Genetic diversity and metabolic profile of Salvia officinalis populations: Implications for advanced breeding strategies. Planta 2017; 246(2): 201-15.
15
Jug-Dujaković M, Ninčević T, Liber Z, Grdiša M, Šatović Z. Salvia officinalis survived in situ Pleistocene glaciation in ‘refugia within refugia’ as inferred from AFLP markers. Plant Syst Evol 2020; 306(2): 38.
16
Skoula M, Hilali IE, Makris AM. Evaluation of the genetic diversity of Salvia fruticosa Mill. clones using RAPD markers and comparison with the essential oil profiles. Biochem Syst Ecol 1999; 27(6): 559-68.
17
Leontaritou P, Lamari FN, Papasotiropoulos V, Iatrou G. Morphological, genetic and essential oil variation of Greek sage (Salvia fruticosa Mill.) populations from Greece. Ind Crops Prod 2020; 150: 112346.
18
Joseph P C. Genetic diversity among varieties of Chia (Salvia hispanica L.). Genet Resour Crop Evol 2004; 51(7): 773-81.
19
Erbano M, Schühli G, Santos É. Genetic variability and population structure of Salvia lachnostachys: Implications for breeding and conservation programs. Int J Mol Sci 2015; 16(12): 7839-50.
20
Song Z, Li X, Wang H, Wang J. Genetic diversity and population structure of Salvia miltiorrhiza Bge in China revealed by ISSR and SRAP. Genetica 2010; 138(2): 241-9.
21
Zhang Y, Li X, Wang Z. Diversity evaluation of Salvia miltiorrhiza using ISSR markers. Biochem Genet 2013; 51(9-10): 707-21.
22
Takano A. Taxonomic study on Japanese Salvia (Lamiaceae): Phylogenetic position of S. akiensis, and polyphyletic nature of S. lutescens var. intermedia. PhytoKeys 2017; 80(80): 87-104.
23
Casselman I. Genetics and phytochemistry of Salvia divinorum. Lismore, NSW: PhD thesis, Southern Cross University. 2016.
24
Sudarmono , Okada H. Genetic differentiations among the populations of Salvia japonica (Lamiaceae) and its related species. Hayati J Biosci 2008; 15(1): 18-26.
25
Dizkirici A, Celep F, Kansu C, Kahraman A, Dogan M, Kaya Z. A molecular phylogeny of Salvia euphratica sensu lato (Salvia L., Lamiaceae) and its closely related species with a focus on the section Hymenosphace. Plant Syst Evol 2015; 301(10): 2313-23.
26
Ince AG, Karaca M. Genetic variation in common bean landraces efficiently revealed by Td-DAMD-PCR markers. Plant Omics 2011; 4(4): 220-7.
27
Ince AG, Karaca M. Species-specific touch-down DAMD-PCR markers for Salvia species. J Med Plants Res 2012; 6(9): 1590-5.
28
Deniz İG, Genç İ, Ince AG, et al. Taxonomic data supporting differences between Allium elmaliense and Allium cyrilli. Biologia 2013; 68(3): 373-83.
29
İnce AG, Karaca M. Td-DAMD-PCR assays for fingerprinting of commercial carnations. Turk J Biol 2015; 39: 290-8.
30
Gocer EU, Karaca M. Genetic characterization of some commercial cotton varieties using Td-DAMD-PCR markers. J Sci Eng Res 2016; 3(4): 487-94.
31
Saleh B. Genetic diversity of Salvia tomentosa Miller (Lamiaceae) species assessment using Td-DAMD molecular marker. Acta Biol Szeged 2019; 63(2): 135-41.
32
Saleh B. TU-DAMD employment for molecular characterization of Salvia judaica and Salvia palaestina species. Acta Biol Szeged 2021; 65(1): 11-6.
33
Saleh B. Genetic diversity of Origanum syriacum L. (Lamiaceae) species through Touch-Up Direct Amplification of Minisatellite-region DNA (TU-DAMD) marker. Not Sci Biol 2022; 14(2): 11174.
34
Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 1987; 19: 11-5.
35
Statsoft 2003. Statistica (Data analysis software system), version 6. Statsoft Inc 2003.
36
Nei M, Li WH. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci 1979; 76(10): 5269-73.
37
Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 1980; 32(3): 314-31.
38
Powell W, Morgante M, Andre C, et al. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol Breed 1996; 2(3): 225-38.
39
Altindal D. Determination of genetic diversity of natural sage populations in Muğla region of Turkey. Int J Environ Sci Technol 2019; 16(2): 1-6.
40
Sepehary-Javan Z, Rahmani F, Heidari R. Assessment of genetic variation of genus Salvia by RAPD and ISSR markers. Aust J Crop Sci 2012; 6: 1068-73.
41
Tychonievich J, Warner RM. Interspecific crossability of selected Salvia species and potential use for crop improvement. J Am Soc Hortic Sci 2011; 136(1): 41-7.